Want to know:
Which sixteenth century scientist proposed the heliocentric theory which was later supported by Galileo?
Get a detailed, AI-powered explanation for this question and thousands more on StudyFetch.
Get the Answer for FreeHow StudyFetch Helps You Master This Topic
AI-Powered Answers
Get instant, detailed explanations powered by AI that understands your course material.
Deep Understanding
Go beyond surface-level answers with step-by-step breakdowns and examples.
Personalized Learning
Sparky adapts to your learning style and helps you connect ideas.
Practice & Test
Turn any question into flashcards, quizzes, and practice tests to solidify your knowledge.
Explore More Questions
- The Three Fifths clausea) was essential to maintain the support of the Southern Planters for the efforts to construct a new form of governmentb) was primarily a calculation on the part of northern states based on their concerns about the distribution of congressional seatsc) increased the number of representative in the national legislature from the southern statesd) all of the above
- Most sedimentary rocks have open spaces in addition to the solid materials. • These open spaces are called .............
- At each __________ , a four-nucleotide sequence is repeated many times in a row. The number of repeats varies widely within the human population. For example: AGATAGATAGATAGATAGAT