Want to know:
Based on your interpretation of the passage above and your own knowledge, why did nineteenth-century nation-states, or ethnic groups aspiring to their own nation-state see a 'homogenous educational elite' as key to the construction and maintenance of a modern nation-state? Select the most persuasive answer below
Get a detailed, AI-powered explanation for this question and thousands more on StudyFetch.
Get the Answer for FreeHow StudyFetch Helps You Master This Topic
AI-Powered Answers
Get instant, detailed explanations powered by AI that understands your course material.
Deep Understanding
Go beyond surface-level answers with step-by-step breakdowns and examples.
Personalized Learning
Sparky adapts to your learning style and helps you connect ideas.
Practice & Test
Turn any question into flashcards, quizzes, and practice tests to solidify your knowledge.
Explore More Questions
- what is the outer layer of a coelenterate?
- Stopa cukrzycowaa zapalenie wysiękowe zgorzelinoweb zapalenie wysiękowe surowiczec ropieńd ropniak
- At each __________ , a four-nucleotide sequence is repeated many times in a row. The number of repeats varies widely within the human population. For example: AGATAGATAGATAGATAGAT